APCAGLPlCx

Cystic Fibrosis-139 Carrier Screen - AA001a

Test Codes
Test Code
Deliverable
Offering
AA001a
Report
Clinical Research
Loading...
Ordering Information
  • Blood: 4-6mL in Lavender Top (EDTA) Tubes
14 days
Yes
Yes
Detailed Test Information
Carrier Screening
Cystic Fibrosis
The Cystic Fibrosis Carrier Screening Panel is intended to evaluate carrier status for cystic fibrosis (CF), which is an autosomal recessive condition caused by pathogenic variants in the CFTR gene.

Test Information: The Cystic Fibrosis-139 Carrier Screen panel is intended to evaluate carrier status for cystic fibrosis (CF), which is an autosomal recessive condition caused by pathogenic variants in the CFTR gene. This is an FDA-cleared next generation sequencing assay designed to detect 139 clinically relevant CF-associated variants as defined in CFTR2 database. It is intended for use in adults of reproductive age, for confirmatory diagnostic testing of newborns and children, or as an initial test to aid in the diagnosis of individuals with suspected CF.

PLEASE NOTE: This is a screening test that does not detect all pathogenic variants associated with cystic fibrosis. It is NOT indicated for newborn screening, fetal diagnostic testing, preimplantation genetic diagnosis, or for stand-alone diagnostic use.

Methodology: Genomic DNA (gDNA) is extracted from the submitted patient specimen and evaluated for quality and quantity using standard procedures. It is processed to identify targeted CFTR variants following the manufacturer’s package insert instructions (Illumina, , San Diego, CA). Next generation sequencing is performed using the MiSeqDX instrument (Illumina, San Diego, CA). A final summary report with the mutation status of the sample was generated at the end of the data processing.

This test is validated to assess the presence of 139 CF associated variants, including the 23 mutations specified in the American College of Medical Genetics (ACMG) standards for population-based carrier screening (PMID: 32404922). Variants in the PolyT/TG tract variant are only reported if the R117H variant is identified. The assay cannot determine whether a PolyT/TG tract variant is in cis (on the same chromosome) or trans (on the opposite chromosome) with the p.Arg117His variant. Therefore, additional testing may be warranted, as whether the variants are in cis or trans can impact predicted clinical phenotype. Three benign variants, c.1516A>G (p.Ile506Val), c.1519A>G (p.Ile507Val) and c.1523T>G (p.Phe508Cys) are also conditionally reported based on the presence of homozygous c.1521_1523delCTT (p.Phe508del) and/or c.1519_1521delATC (p.Ile507del) variants.

The following clinically relevant CFTR variants are assessed by this test : c.1A>G; c.54- 5940_273+10250del21kb; c.115C>T; c.178G>T; c.200C>T; c.223C>T; c. 254G>A; c.262_263delTT; c.273+1G>A; c.274-1G>A; c.274G>T; c.274G>A; c.292C>T; c.325_327delTATinsG; c.328G>C; c.349C>T; c.350G>A; c.366T>A; c.442delA; c. 489+1G>T; c.531delT; c.532G>A; c.579+1G>T; c.579+3A>G; c.579+5G>A; c.580-1G>T; c.595C>T; c.613C>T; c.617T>G; c.658C>T; c. 720_741delAGGGAGAATGATGATGAAGTAC; c.948delT; c.988G>T; c.1000C>T; c.1007T>A; c.1013C>T; c.1021T>C; c.1022_1023insTC; c.1040G>A; c.1040G>C; c. 1055G>A; c.1081delT; c.1116+1G>A; c.1127_1128insA; c.1202G>A; c.1203G>A; c.1209+1G>A; c.1329_1330insAGAT; c.1364C>A; c.1393-1G>A; c.1397C>A; c. 1397C>G; c.1400T>C; c.1418delG; c.1466C>A; c.1475C>T; c.1477C>T; c.1519_1521delATC; c.1521_1523delCTT; c.1545_1546delTA; c.1558G>T; c.1573C>T; c.15851G>A; c.1585-8G>A; c.1624G>T; c.1645A>C; c.1646G>A; c.1647T>G; c.1652G>A; c.1654C>T; c.1657C>T; c.1675G>A; c.1679G>A; c.1679G>C; c.1679+1.6kbA>G; c. 1680-1G>A; c.1753G>T; c.1766+1G>A; c.1766+3A>G; c.2012delT; c.2051_2052delAAinsG; c.2052delA; c.2052_2053insA; c.2125C>T; c.2128A>T; c.2175_2176insA; c. 2195T>G; c.2215delG; c.2290C>T; c.2453delT; c.2464G>T; c.2490+1G>A; c.2491G>T; c.2537G>A; c.2551C>T; c.2583delT; c.2657+5G>A; c.2668C>T; c.2780T>C; c. 2834C>T; c.2875delG; c.2908G>C; c.2988G>A; c.2988+1G>A; c.2989-1G>A; c.3140-26A>G; c.3194T>C; c.3196C>T; c.3197G>A; c.3230T>C; c.3266G>A; c.3276C>A; c. 3276C>G; c.3302T>A; c.3310G>T; c.3472C>T; c.3484C>T; c.3528delC; c.3587C>G; c.3611G>A; c.3612G>A; c.3659delC; c.3717+12191C>T; c.3731G>A; c.3744delA; c. 3752G>A; c.3773_3774insT; c.3846G>A; c.3873+1G>A; c.3884_3885insT; c.3909C>G; c.3937C>T; c.3964- 78_4242+577del; c.4077_4080delTGTTinsAA; c.4251delA; c.1210-12T[5-9]/c.1210-34TG[11-13] variants; c.1516A>G; c.1519A>G; c.1523T>G.

Limitations: A negative result reduces but does not eliminate the possibility that this individual carries a pathogenic variant in CFTR and does not guarantee present or future health. This is a screening test that targets 139 known variants associated with cystic fibrosis. It does not detect all pathogenic variants associated with cystic fibrosis. Carrier detection rates and test sensitivity are dependent on an individual's ethnic background as many of the detected pathogenic variants are more common among individuals of certain ethnicity. This test detects about 95.4% of CF-causing alleles in patients with CF in the CFTR2 Project patient cohort 1. This assay does not determine whether a variant is inherited. As with any hybridization-based assay, variants in oligonucleotide binding regions can impact probe binding and consequently variant called. This assay cannot guarantee all regions will meet variant calling criteria due to technical limitations and/or possible underlying genomic changes.

The interpretation of this test is based on the assumption that the clinical information and family relationships provided to the laboratory are accurate. In addition, the interpretation of these results is based on currently available scientific knowledge. Variant interpretation may change over time if more information becomes available. It is recommended that genetic test results be periodically reinterpreted. Healthcare providers can contact the laboratory to determine if there have been any changes to the interpretation of a variant or a result. Although rare, the accuracy of results may also be impacted due to sample mix-up, DNA contamination, poor DNA quality, or the presence of pre-malignant or malignant cells in the sample, as well as in the setting of bone marrow transplantation or a recent blood transfusion.

Laboratory Information: Genosity is a College of American Pathologists (CAP)-accredited and Clinical Laboratory Improvement Amendments (CLIA)-certified clinical diagnostic laboratory (CAP#: 8289311; CLIA #31D2142534) located at 485F US Route 1 South, Suite 110, Iselin, NJ 08830.



Show less